Skip to main content

pKF257
(Plasmid #52533)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 52533 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCASPER5
  • Backbone size w/o insert (bp) 10877
  • Total vector size (bp) 11667
  • Vector type
    Insect Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    I-SceI
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    831
  • Entrez Gene
    SCEI (a.k.a. Q0160)
  • Promoter tubulin
  • Tags / Fusion Proteins
    • NLS (N terminal on insert)
    • HA (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site KpnI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer ctcgcacgcagtgccggctcaag
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    a fly strain containing I-SceI nuclease, obtained from Bloomington stock center

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKF257 was a gift from Klaus Foerstemann (Addgene plasmid # 52533 ; http://n2t.net/addgene:52533 ; RRID:Addgene_52533)
  • For your References section:

    Efficient chromosomal gene modification with CRISPR/cas9 and PCR-based homologous recombination donors in cultured Drosophila cells. Bottcher R, Hollmann M, Merk K, Nitschko V, Obermaier C, Philippou-Massier J, Wieland I, Gaul U, Forstemann K. Nucleic Acids Res. 2014 Apr 19. 10.1093/nar/gku289 PubMed 24748663