Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pAAV CaMKIIa ChR2 E90R D156N T159C 2A tDimer
(Plasmid #52878)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 52878 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pAAV
  • Backbone manufacturer
    Stratagene
  • Backbone size w/o insert (bp) 5420
  • Total vector size (bp) 7826
  • Modifications to backbone
    CaMKIIa promoter
  • Vector type
    Mammalian Expression, AAV

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    Channelrhodopsin-2
  • Alt name
    ChR2
  • Species
    Chlamydomonas
  • Insert Size (bp)
    927
  • Mutation
    E90R, D156N, T159C
  • Promoter CaMKIIa

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site MluI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer CAGGGCAAAGAGGAGCAGG
  • 3′ sequencing primer GATTCTCCTCCACGTCACCGC
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    red fluorescent protein
  • Alt name
    tdimer2(12)
  • Species
    Discosoma sp.
  • Insert Size (bp)
    1395
  • Promoter CaMKIIa

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer GCGGTGACGTGGAGGAGAATC
  • 3′ sequencing primer GATGAGTTCCGCCGTGGCAAT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ChR orginally from P. Hegemann- HUBerlin, Germany tDimer orginally from R.Tsien USD USA

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV CaMKIIa ChR2 E90R D156N T159C 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 52878 ; http://n2t.net/addgene:52878 ; RRID:Addgene_52878)
  • For your References section:

    Conversion of Channelrhodopsin into a Light-Gated Chloride Channel. Wietek J, Wiegert JS, Adeishvili N, Schneider F, Watanabe H, Tsunoda SP, Vogt A, Elstner M, Oertner TG, Hegemann P. Science. 2014 Mar 27. 10.1126/science.1249375 PubMed 24674867