pAAV CaMKIIa ChR2 E90R D156N T159C 2A tDimer
(Plasmid
#52878)
-
PurposeChloride-conducting Channelrhodopsin with slow kinetics, neuron-specific promoter, plus red fluorescent protein, excitatory neurons
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52878 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5420
- Total vector size (bp) 7826
-
Modifications to backboneCaMKIIa promoter
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameChannelrhodopsin-2
-
Alt nameChR2
-
SpeciesChlamydomonas
-
Insert Size (bp)927
-
MutationE90R, D156N, T159C
- Promoter CaMKIIa
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site MluI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer CAGGGCAAAGAGGAGCAGG
- 3′ sequencing primer GATTCTCCTCCACGTCACCGC (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert namered fluorescent protein
-
Alt nametdimer2(12)
-
SpeciesDiscosoma sp.
-
Insert Size (bp)1395
- Promoter CaMKIIa
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GCGGTGACGTGGAGGAGAATC
- 3′ sequencing primer GATGAGTTCCGCCGTGGCAAT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byChR orginally from P. Hegemann- HUBerlin, Germany tDimer orginally from R.Tsien USD USA
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV CaMKIIa ChR2 E90R D156N T159C 2A tDimer was a gift from Thomas Oertner (Addgene plasmid # 52878 ; http://n2t.net/addgene:52878 ; RRID:Addgene_52878) -
For your References section:
Conversion of Channelrhodopsin into a Light-Gated Chloride Channel. Wietek J, Wiegert JS, Adeishvili N, Schneider F, Watanabe H, Tsunoda SP, Vogt A, Elstner M, Oertner TG, Hegemann P. Science. 2014 Mar 27. 10.1126/science.1249375 PubMed 24674867