pMos-3xP3DsRed-attP
(Plasmid
#52904)
-
Purpose(Empty Backbone) Mos1 transformation vector containing MCS, loxP, attP, 2 x 5HE
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 52904 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepMos3xP3DsRED
- Backbone size (bp) 5935
-
Modifications to backbonePlasmid pMos-3xP3DsRed-attP was generated by inserting two clusters of homing endonuclease recognition sites (Traver et al., 2009) and loxP target sites flanking the multiple cloning site(MCS), as well as an attP recombination site downstream of the MCS.
-
Vector typeInsect Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Cloning Information
- 5′ sequencing primer TTCACTGCATTCTAGTTGTGGTTTGTCC
- 3′ sequencing primer CGAATAAAGAGCAAACGCGGACAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
attP site is gtagtgccccaactggggtaacctttgagttctctcagttgggggcgtag
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMos-3xP3DsRed-attP was a gift from Zach Adelman (Addgene plasmid # 52904 ; http://n2t.net/addgene:52904 ; RRID:Addgene_52904) -
For your References section:
Validation of novel promoter sequences derived from two endogenous ubiquitin genes in transgenic Aedes aegypti. Anderson MA, Gross TL, Myles KM, Adelman ZN. Insect Mol Biol. 2010 Aug;19(4):441-9. doi: 10.1111/j.1365-2583.2010.01005.x. Epub 2010 Apr 26. 10.1111/j.1365-2583.2010.01005.x PubMed 20456509