pXylA-agrCA-IV
(Plasmid
#53438)
-
Purposexylose-dependent expression of the type-IV agrC and type-I agrA genes of S. aureus
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53438 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepT7-RNAP
-
Backbone manufacturerMoBiTec
- Backbone size w/o insert (bp) 8812
- Total vector size (bp) 8209
-
Modifications to backboneThe T7 rnap gene was replaced by the type-IV agrC gene and the type-I agrA gene of S. aureus (taken from the pAgrC4agrA vector)
-
Vector typeBacterial Expression, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsMS941 E. coli is used for expression. pT7-RNAP contains the genes of ampicillin and chloramphenicol for easy selection in E. coli (AmpR) and B. megaterium (CmR).
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameagrCA locus
-
SpeciesS. aureus
-
Insert Size (bp)2065
-
Mutation"MVQTS" sequence added to the N-terminus of AgrC
- Promoter PxylA
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SpeI (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer 5' - ccactcctttgtttatccaccg - 3'
- 3′ sequencing primer 5' - agtacaaccaagagaacggaggc - 3' (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe agrCA genes in this plasmid were cloned from the pAgrC4agrA plasmid provided by Paul Williams group (ref: Jensen et al. J. Mol. Biol. 2008)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pXylA-agrCA-IV was a gift from Cynthia Collins (Addgene plasmid # 53438 ; http://n2t.net/addgene:53438 ; RRID:Addgene_53438) -
For your References section:
Peptide-based communication system enables Escherichia coli to Bacillus megaterium interspecies signaling. Marchand N, Collins CH. Biotechnol Bioeng. 2013 Nov;110(11):3003-12. doi: 10.1002/bit.24975. Epub 2013 Jul 5. 10.1002/bit.24975 PubMed 23775238