Skip to main content

Chicken ArcLight Q175
(Plasmid #53566)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53566 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 5701
  • Total vector size (bp) 6955
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chicken ArcLight-Q175
  • Alt name
    Chicken-Q175
  • Alt name
    Gg-VSD ArcLight Q175
  • Species
    G. gallus (chicken), Synthetic; Aequorea victoria
  • Insert Size (bp)
    1254
  • Mutation
    Gg-VSP contains an R153Q mutation and an amino acid E (GAG) was introduced immediately after the start M (ATG); Gg-VSP is truncated at Q176 (Q175 in the original Gg-VSP sequence) and super ecliptic pHluorin containing a A227D (FP numbering) mutation is fused to the C-terminal (after Q176).
  • GenBank ID
    XP_417079.2 AY533296
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGAGGGTGAAGGTGATGCAACATAC
  • 3′ sequencing primer ACCTTCGGGCATGGCACTCTTG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The chicken voltage sensitive phosphatase (VSP) sequence used in this construct contains an E14K mutation, when compared to the reference sequence XP_417079.2. This mutation could be polymorphism at the site or a PCR error. The depositing laboratory states that the plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Chicken ArcLight Q175 was a gift from Vincent Pieribone (Addgene plasmid # 53566 ; http://n2t.net/addgene:53566 ; RRID:Addgene_53566)
  • For your References section:

    Fluorescent protein voltage probes derived from ArcLight that respond to membrane voltage changes with fast kinetics. Han Z, Jin L, Platisa J, Cohen LB, Baker BJ, Pieribone VA. PLoS One. 2013 Nov 27;8(11):e81295. doi: 10.1371/journal.pone.0081295. eCollection 2013. 10.1371/journal.pone.0081295 PubMed 24312287