Chicken ArcLight Q175
(Plasmid
#53566)
-
PurposeGenetically encoded voltage sensor ArcLight with improved kinetics
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 53566 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 5701
- Total vector size (bp) 6955
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChicken ArcLight-Q175
-
Alt nameChicken-Q175
-
Alt nameGg-VSD ArcLight Q175
-
SpeciesG. gallus (chicken), Synthetic; Aequorea victoria
-
Insert Size (bp)1254
-
MutationGg-VSP contains an R153Q mutation and an amino acid E (GAG) was introduced immediately after the start M (ATG); Gg-VSP is truncated at Q176 (Q175 in the original Gg-VSP sequence) and super ecliptic pHluorin containing a A227D (FP numbering) mutation is fused to the C-terminal (after Q176).
-
GenBank IDXP_417079.2 AY533296
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BamHI (not destroyed)
- 5′ sequencing primer AGAGGGTGAAGGTGATGCAACATAC
- 3′ sequencing primer ACCTTCGGGCATGGCACTCTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The chicken voltage sensitive phosphatase (VSP) sequence used in this construct contains an E14K mutation, when compared to the reference sequence XP_417079.2. This mutation could be polymorphism at the site or a PCR error. The depositing laboratory states that the plasmid functions as described in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Chicken ArcLight Q175 was a gift from Vincent Pieribone (Addgene plasmid # 53566 ; http://n2t.net/addgene:53566 ; RRID:Addgene_53566) -
For your References section:
Fluorescent protein voltage probes derived from ArcLight that respond to membrane voltage changes with fast kinetics. Han Z, Jin L, Platisa J, Cohen LB, Baker BJ, Pieribone VA. PLoS One. 2013 Nov 27;8(11):e81295. doi: 10.1371/journal.pone.0081295. eCollection 2013. 10.1371/journal.pone.0081295 PubMed 24312287