Zebrafish ArcLight Q175
(Plasmid
#53616)
-
PurposeGenetically encoded voltage sensor ArcLight with improved kinetics
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53616 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCS2+
- Backbone size w/o insert (bp) 5701
- Total vector size (bp) 6955
-
Vector typeMammalian Expression
-
Selectable markersHygromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameZebrafish ArcLight-Q175
-
Alt nameZebrafish-Q175
-
Alt nameDr-VSD ArcLight Q175
-
SpeciesD. rerio (zebrafish), Synthetic; Aequorea victoria
-
Insert Size (bp)1254
-
MutationDr-VSD contains R153Q mutation and an amino acid E (GAG) introduced immediately after starting M (ATG); Dr-VSP is truncated at Q176 (Q175 in the original Dr-VSP sequence) and super ecliptic pHluorin containing a A227D (FP numbering) mutation is fused to the C-terminal (after Q176).
-
GenBank IDNP_001020629.1 AY533296
-
Entrez Genetpte (a.k.a. tpip, vsp, wu:fd20e11, wu:fi24b06)
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BgIII (destroyed during cloning)
- 5′ sequencing primer AGAGGGTGAAGGTGATGCAACATAC
- 3′ sequencing primer ACCTTCGGGCATGGCACTCTTG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
Zebrafish ArcLight Q175 was a gift from Vincent Pieribone (Addgene plasmid # 53616 ; http://n2t.net/addgene:53616 ; RRID:Addgene_53616) -
For your References section:
Fluorescent protein voltage probes derived from ArcLight that respond to membrane voltage changes with fast kinetics. Han Z, Jin L, Platisa J, Cohen LB, Baker BJ, Pieribone VA. PLoS One. 2013 Nov 27;8(11):e81295. doi: 10.1371/journal.pone.0081295. eCollection 2013. 10.1371/journal.pone.0081295 PubMed 24312287