Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

Zebrafish ArcLight Q175
(Plasmid #53616)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 53616 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 5701
  • Total vector size (bp) 6955
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Zebrafish ArcLight-Q175
  • Alt name
    Zebrafish-Q175
  • Alt name
    Dr-VSD ArcLight Q175
  • Species
    D. rerio (zebrafish), Synthetic; Aequorea victoria
  • Insert Size (bp)
    1254
  • Mutation
    Dr-VSD contains R153Q mutation and an amino acid E (GAG) introduced immediately after starting M (ATG); Dr-VSP is truncated at Q176 (Q175 in the original Dr-VSP sequence) and super ecliptic pHluorin containing a A227D (FP numbering) mutation is fused to the C-terminal (after Q176).
  • GenBank ID
    NP_001020629.1 AY533296
  • Entrez Gene
    tpte (a.k.a. tpip, vsp, wu:fd20e11, wu:fi24b06)
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BgIII (destroyed during cloning)
  • 5′ sequencing primer AGAGGGTGAAGGTGATGCAACATAC
  • 3′ sequencing primer ACCTTCGGGCATGGCACTCTTG
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Zebrafish ArcLight Q175 was a gift from Vincent Pieribone (Addgene plasmid # 53616 ; http://n2t.net/addgene:53616 ; RRID:Addgene_53616)
  • For your References section:

    Fluorescent protein voltage probes derived from ArcLight that respond to membrane voltage changes with fast kinetics. Han Z, Jin L, Platisa J, Cohen LB, Baker BJ, Pieribone VA. PLoS One. 2013 Nov 27;8(11):e81295. doi: 10.1371/journal.pone.0081295. eCollection 2013. 10.1371/journal.pone.0081295 PubMed 24312287