Skip to main content

Chicken Mermaid S188
(Plasmid #53617)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53617 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCS2+
  • Backbone size w/o insert (bp) 5694
  • Total vector size (bp) 7614
  • Vector type
    Mammalian Expression
  • Selectable markers
    Hygromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Top10
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chicken Mermaid S188
  • Alt name
    Gg-VSD Mermaid S188
  • Species
    G. gallus (chicken), Synthetic
  • Insert Size (bp)
    1920
  • Mutation
    Gg-VSP contains an R153Q mutation and an amino acid E (GAG) was introduced immediately after the start M (ATG); Gg-VSP is truncated at S189 (S188 in the native Gg-VSP sequence) and the FRET fluorescent protein pair from the voltage probe Mermaid is fused to the C-terminal (after S189).
  • GenBank ID
    XP_417079.2
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BamHI (not destroyed)
  • 5′ sequencing primer AGCTGTATGAGAATGCGGTTGC
  • 3′ sequencing primer ATGTCCCTCGTAAGGTCTGCCTGTGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The FRET pair present in this probe was derived from the Mermaid voltage sensor (Tsutsui et al., 2008). Tsutsui H, Karasawa S, Okamura Y, Miyawaki A. Improving membrane voltage measurements using FRET with new fluorescent proteins. Nat Methods 5: 683–685, 2008.
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

The chicken voltage sensitive phosphatase (VSP) sequence used in this construct contains an E14K mutation, when compared to the reference sequence XP_417079.2. This mutation could be polymorphism at the site or a PCR error. The depositing laboratory states that the plasmid functions as described in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Chicken Mermaid S188 was a gift from Vincent Pieribone (Addgene plasmid # 53617 ; http://n2t.net/addgene:53617 ; RRID:Addgene_53617)
  • For your References section:

    Fluorescent protein voltage probes derived from ArcLight that respond to membrane voltage changes with fast kinetics. Han Z, Jin L, Platisa J, Cohen LB, Baker BJ, Pieribone VA. PLoS One. 2013 Nov 27;8(11):e81295. doi: 10.1371/journal.pone.0081295. eCollection 2013. 10.1371/journal.pone.0081295 PubMed 24312287