-
PurposePlacUV5-directed synthesis of the λCI protein; used as two-hybrid control. For cloning purposes, see Addgene plasmid 53733.
-
Depositing Lab
-
Depositing OrganizationHarvard Medical School
Located in United States of America -
Publication
-
Citations
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 53730 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepACYC184
-
Backbone manufacturerATCC
- Backbone size w/o insert (bp) 2500
- Total vector size (bp) 3185
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB5alpha F'LacIQ
-
Growth instructionsWe recommend using a lacIQ strain, such as NEB5alpha F'LacIQ, in order to ensure that the expression of potentially toxic fusion proteins is kept repressed.
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert namebacteriophage lambda CI protein
-
Alt nameλCI
-
Speciesbacteriophage lambda
-
Insert Size (bp)710
- Promoter lac UV5
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NA (unknown if destroyed)
- 3′ cloning site NA (unknown if destroyed)
- 5′ sequencing primer pAC-cI_F (approx 100bp upstream of NotI site in the pAC-cI vector) 5’ gatcagggatagcggtcagg 3’
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid is used in conjuction with the other Ann Hochschild Bacterial 2-hybrid system plasmids (Addgene plasmids 53730, 53731, 53732, 53733, and 53734) and must be used in the reporter strain, FW102 OL2–62 (Addgene item 53735). Please see the associated article for links to all of these plasmids:
http://www.addgene.org/browse/article/8393/
Please note the sequence-based map incorrectly shows the insert as "cI857 LR”. This is incorrect-cI857 refers to a temperature sensitive allele of cI, but the gene in the plasmid is wild type.
The following articles can provide more information on using the bacterial 2-hybrid system:
Dove, et al. 1997 PMID 9121589
Dove and Hochschild 1998 PMID 9499408
Deaconescu, et al. 2006 PMID 16469698
Deighan, et al. 2008 PMID 18832144
Kuznedelov, et al. 2002 PMID 11823642
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACλCI was a gift from Ann Hochschild (Addgene plasmid # 53730 ; http://n2t.net/addgene:53730 ; RRID:Addgene_53730) -
For your References section:
Activation of prokaryotic transcription through arbitrary protein-protein contacts. Dove SL, Joung JK, Hochschild A. Nature. 1997 Apr 10;386(6625):627-30. 10.1038/386627a0 PubMed 9121589