Skip to main content

pBRα-σ70 D581G
(Plasmid #53732)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 53732 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBR322
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB5alpha F'LacIQ
  • Growth instructions
    We recommend using a lacIQ strain, such as NEB5alpha F'LacIQ, in order to ensure that the expression of potentially toxic fusion proteins is kept repressed.
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    RNAP alpha NTD (aa 1-248) fused to E. coli sigma 70 (aa 528-613)
  • Alt name
    rpoA-rpoD fusion
  • Species
    E. coli
  • Mutation
    The sigma 70 moiety carries the D581G substitution
  • Promoter lpp/lacUV5 (tandem promoter)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NA (unknown if destroyed)
  • 3′ cloning site NA (unknown if destroyed)
  • 5′ sequencing primer pBRa_F (approx 100 bp upstream of hte 3' end of alpha NTD) 5’ gaacagcgtaccgacctggac 3’
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

This plasmid is used in conjuction with the other Ann Hochschild Bacterial 2-hybrid system plasmids (Addgene plasmids 53730, 53731, 53732, 53733, and 53734) and must be used in the reporter strain, FW102 OL2–62 (Addgene item 53735). Please see the associated article for links to all of these plasmids:
http://www.addgene.org/browse/article/8393/

The following articles can provide more information on using the bacterial 2-hybrid system:
Dove, et al. 1997 PMID 9121589
Dove and Hochschild 1998 PMID 9499408
Deaconescu, et al. 2006 PMID 16469698
Deighan, et al. 2008 PMID 18832144
Kuznedelov, et al. 2002 PMID 11823642

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBRα-σ70 D581G was a gift from Ann Hochschild (Addgene plasmid # 53732 ; http://n2t.net/addgene:53732 ; RRID:Addgene_53732)
  • For your References section:

    Activation of prokaryotic transcription through arbitrary protein-protein contacts. Dove SL, Joung JK, Hochschild A. Nature. 1997 Apr 10;386(6625):627-30. 10.1038/386627a0 PubMed 9121589