-
PurposeRatiometric (Blue to Green) fluorescent indicator for calcium signaling in the endoplasmic reticulum
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 58217 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepBluescript SK-
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5148
- Total vector size (bp) 6625
-
Modifications to backboneCAG promoter and polyA sequence were inserted.
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGEM-CEPIA1er
-
Alt nameratiometric (blue to geen) fluorescent calcium-measuring organelle-entrapped protein indicator for the endoplasmic reticulum
-
SpeciesSynthetic
-
Insert Size (bp)1477
-
MutationGEM-GECO1 E298D F359W D400E E407D
- Promoter CAG
-
Tag
/ Fusion Protein
- myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site SpeI (not destroyed)
- 5′ sequencing primer tagagcctctgctaaccatg
- 3′ sequencing primer tagccacctttgttcatggc (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCIS GEM-CEPIA1er was a gift from Masamitsu Iino (Addgene plasmid # 58217 ; http://n2t.net/addgene:58217 ; RRID:Addgene_58217) -
For your References section:
Imaging intraorganellar Ca(2+) at subcellular resolution using CEPIA. Suzuki J, Kanemaru K, Ishii K, Ohkura M, Okubo Y, Iino M. Nat Commun. 2014 Jun 13;5:4153. doi: 10.1038/ncomms5153. 10.1038/ncomms5153 PubMed 24923787