pCIS GEM-CEPIA1er
(Plasmid #58217)

• Purpose: Ratiometric (Blue to Green) fluorescent indicator for calcium signaling in the endoplasmic reticulum
• Depositing Lab: Masamitsu Iino
• Publication: Suzuki et al Nat Commun. 2014 Jun 13;5:4153. doi: 10.1038/ncomms5153.

Backbone

• Vector backbone: pBluescript SK-
• Backbone manufacturer: Stratagene
• Backbone size w/o insert (bp): 5148
• Total vector size (bp): 6625
• Modifications to backbone: CAG promoter and polyA sequence were inserted.
• Vector type: Mammalian Expression

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: GEM-CEPIA1er
• Alt name: ratiometric (blue to geen) fluorescent calcium-measuring organelle-entrapped protein indicator for the endoplasmic reticulum
• Species: Synthetic
• Insert Size (bp): 1477
• Mutation: GEM-GECO1 E298D F359W D400E E407D
• Promoter: CAG
• Tag / Fusion Protein:
  • myc (C terminal on insert)

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: HindIII (not destroyed)
• 3′ cloning site: SpeI (not destroyed)
• 5′ sequencing primer: tagagcctctgctaaccatg
• 3′ sequencing primer: tagccacctttgttcatggc

Resource Information

• Articles Citing this Plasmid:
  • 5 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry