-
PurposeGreen fluorescent indicator for calcium imaging in the mitochondria
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58218 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCMV/myc/mito
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 4799
- Total vector size (bp) 6404
-
Modifications to backboneDuplicate mitochondria targeting sequence.
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCEPIA2mt
-
Alt namegreen fluorescent calcium-measuring organelle-entrapped protein indicator for the mitochondria
-
SpeciesSynthetic
-
Insert Size (bp)1605
-
MutationGCaMP2 N263Y E282V M339L
- Promoter CMV
-
Tag
/ Fusion Protein
- myc (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site unknown (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer cgcaaatgggcggtaggcgtg
- 3′ sequencing primer tagaaggcacagtcgagg (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCMV CEPIA2mt was a gift from Masamitsu Iino (Addgene plasmid # 58218 ; http://n2t.net/addgene:58218 ; RRID:Addgene_58218) -
For your References section:
Imaging intraorganellar Ca(2+) at subcellular resolution using CEPIA. Suzuki J, Kanemaru K, Ishii K, Ohkura M, Okubo Y, Iino M. Nat Commun. 2014 Jun 13;5:4153. doi: 10.1038/ncomms5153. 10.1038/ncomms5153 PubMed 24923787