Skip to main content

pACU
(Plasmid #58373)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58373 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUAST
  • Modifications to backbone
    The attB fragment isolated from pAttB by SalI digestion was inserted into the NdeI site of pUAST by blunt ligation.
  • Vector type
    Insect Expression
  • Selectable markers
    mini-white

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer tactccacctcacccatctg
  • 3′ sequencing primer atgatggaccagatgggtgag
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For more information about the Han Lab Drosophila Transgenic Vectors, please visit: https://han.wicmb.cornell.edu/han-lab-drosophila-transgenic-vectors/.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pACU was a gift from Chun Han & Yuh-Nung Jan (Addgene plasmid # 58373 ; http://n2t.net/addgene:58373 ; RRID:Addgene_58373)
  • For your References section:

    Enhancer-driven membrane markers for analysis of nonautonomous mechanisms reveal neuron-glia interactions in Drosophila. Han C, Jan LY, Jan YN. Proc Natl Acad Sci U S A. 2011 Jun 7;108(23):9673-8. doi: 10.1073/pnas.1106386108. Epub 2011 May 23. 10.1073/pnas.1106386108 PubMed 21606367