-
PurposeExpresses diphtheria toxin A subunit in Cre positive cells, and mCherry in all the infected cells
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 58536 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepAAV
-
Backbone manufacturerStratagene
- Backbone size w/o insert (bp) 5604
- Total vector size (bp) 6780
-
Vector typeMammalian Expression, AAV, Cre/Lox
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert namedtA
-
Alt namediphtheria toxin A
-
Insert Size (bp)657
-
GenBank IDX00703.1 AB610405.1
-
Entrez GeneDIP_RS18250 (a.k.a. DIP_RS18250, DIP1414)
- Promoter EF1a
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site BglII (not destroyed)
- 5′ sequencing primer agcaacatagttaagaatac
- 3′ sequencing primer cgagcttttggagtacgtcg (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-mCherry-flex-dtA was a gift from Naoshige Uchida (Addgene plasmid # 58536 ; http://n2t.net/addgene:58536 ; RRID:Addgene_58536) -
For your References section:
Galanin neurons in the medial preoptic area govern parental behaviour. Wu Z, Autry AE, Bergan JF, Watabe-Uchida M, Dulac CG. Nature. 2014 May 15;509(7500):325-30. doi: 10.1038/nature13307. 10.1038/nature13307 PubMed 24828191