Skip to main content

Tg (mpx:mCherry-2A-Rac2D57N)
(Plasmid #58934)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 58934 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Tol2
  • Backbone size w/o insert (bp) 3500
  • Total vector size (bp) 13155
  • Modifications to backbone
    Inserted mpx-mcherry-2a-Rac2D57N

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mcherry-2a-Rac2D57N
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    1353
  • Mutation
    changed Aspartate 57 to Asparagine
  • Entrez Gene
    rac2 (a.k.a. zgc:86686)
  • Promoter mpx
  • Tag / Fusion Protein
    • mcherry2a (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer Gtgaaagtacaagtacttagggaaaa
  • 3′ sequencing primer gtgtggaattgtgagcggataac
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    Tg (mpx:mCherry-2A-Rac2D57N) was a gift from Anna Huttenlocher (Addgene plasmid # 58934 ; http://n2t.net/addgene:58934 ; RRID:Addgene_58934)
  • For your References section:

    Dual roles for Rac2 in neutrophil motility and active retention in zebrafish hematopoietic tissue. Deng Q, Yoo SK, Cavnar PJ, Green JM, Huttenlocher A. Dev Cell. 2011 Oct 18;21(4):735-45. doi: 10.1016/j.devcel.2011.07.013. 10.1016/j.devcel.2011.07.013 PubMed 22014524