-
PurposeBicistronic Lentivirus expressing sox2 and Cre
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59019 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneGFP-Cre Empty vector
- Backbone size w/o insert (bp) 11000
- Total vector size (bp) 12000
-
Modifications to backboneB-actin promoter replaces the Ubc promoter, Sox2 replaces the GFP
-
Vector typeLentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameSox2
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)960
-
GenBank IDNM_011443
-
Entrez GeneSox2 (a.k.a. Sox-2, lcc, ysb)
- Promoter B-actin
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer gcgtcggtcgggctgcaacc
- 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byADDGENE PLASMID #13367 WAS USED AS TEMPLATE FOR CLONING OF SOX2
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
ACTIN-SOX2-PGK Cre was a gift from Trudy Oliver (Addgene plasmid # 59019 ; http://n2t.net/addgene:59019 ; RRID:Addgene_59019) -
For your References section:
Sox2 Cooperates with Lkb1 Loss in a Mouse Model of Squamous Cell Lung Cancer. Mukhopadhyay A, Berrett KC, Kc U, Clair PM, Pop SM, Carr SR, Witt BL, Oliver TG. Cell Rep. 2014 Jul 10;8(1):40-49. doi: 10.1016/j.celrep.2014.05.036. Epub 2014 Jun 19. 10.1016/j.celrep.2014.05.036 PubMed 24953650
Map uploaded by the depositor.
