Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

ACTIN-SOX2-PGK Cre
(Plasmid #59019)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59019 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    GFP-Cre Empty vector
  • Backbone size w/o insert (bp) 11000
  • Total vector size (bp) 12000
  • Modifications to backbone
    B-actin promoter replaces the Ubc promoter, Sox2 replaces the GFP
  • Vector type
    Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Sox2
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    960
  • GenBank ID
    NM_011443
  • Entrez Gene
    Sox2 (a.k.a. Sox-2, lcc, ysb)
  • Promoter B-actin

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer gcgtcggtcgggctgcaacc
  • 3′ sequencing primer CAGCGGGGCTGCTAAAGCGCATGC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    ADDGENE PLASMID #13367 WAS USED AS TEMPLATE FOR CLONING OF SOX2
  • Terms and Licenses
  • Article Citing this Plasmid
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    ACTIN-SOX2-PGK Cre was a gift from Trudy Oliver (Addgene plasmid # 59019 ; http://n2t.net/addgene:59019 ; RRID:Addgene_59019)
  • For your References section:

    Sox2 Cooperates with Lkb1 Loss in a Mouse Model of Squamous Cell Lung Cancer. Mukhopadhyay A, Berrett KC, Kc U, Clair PM, Pop SM, Carr SR, Witt BL, Oliver TG. Cell Rep. 2014 Jul 10;8(1):40-49. doi: 10.1016/j.celrep.2014.05.036. Epub 2014 Jun 19. 10.1016/j.celrep.2014.05.036 PubMed 24953650