Skip to main content

HA-ISceID44A
(Plasmid #59424)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59424 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCAGGS
  • Backbone size w/o insert (bp) 4822
  • Total vector size (bp) 5656
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    endonuclease ISceI mutant
  • Mutation
    changed aspartate 44 to alanine (D44A)
  • Entrez Gene
    I-SceI
  • Tag / Fusion Protein
    • HA tag (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer ATGAAAAACATCAAAAAAAACCAGG
  • 3′ sequencing primer TTA TTT CAG GAA AGT TTC GGA GGA G
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Using as template the HA-ISceI plasmid (Rouet et al., Proc. Natl. Acad. Sci. U.S.A. 91, 6064– 6068,1994), a polymerase chain reaction-based strategy was used to construct the mutant form HA-ISceID44A.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    HA-ISceID44A was a gift from Tom Misteli (Addgene plasmid # 59424 ; http://n2t.net/addgene:59424 ; RRID:Addgene_59424)
  • For your References section:

    Spatial dynamics of chromosome translocations in living cells. Roukos V, Voss TC, Schmidt CK, Lee S, Wangsa D, Misteli T. Science. 2013 Aug 9;341(6146):660-4. doi: 10.1126/science.1237150. 10.1126/science.1237150 PubMed 23929981