Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pGEX-GP-2-MPHOSPH8 Chromo
(Plasmid #59694)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59694 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGEX-6p-2
  • Total vector size (bp) 5131
  • Vector type
    Bacterial Expression
  • Selectable markers
    Ampicilin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    XL1 Blue
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    MPHOSPH8 Chromo
  • Alt name
    MPP8 Chromo
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    194
  • Entrez Gene
    MPHOSPH8 (a.k.a. HSMPP8, TWA3, mpp8)
  • Promoter tac promoter
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-GP-2-MPHOSPH8 Chromo was a gift from Albert Jeltsch (Addgene plasmid # 59694 ; http://n2t.net/addgene:59694 ; RRID:Addgene_59694)
  • For your References section:

    Application of histone modification-specific interaction domains as an alternative to antibodies. Kungulovski G, Kycia I, Tamas R, Jurkowska RZ, Kudithipudi S, Henry C, Reinhardt R, Labhart P, Jeltsch A. Genome Res. 2014 Nov;24(11):1842-53. doi: 10.1101/gr.170985.113. Epub 2014 Oct 9. 10.1101/gr.170985.113 PubMed 25301795