Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGEX-GP-2-KDM4A double Tudor
(Plasmid #59699)


Item Catalog # Description Quantity Price (USD)
Plasmid 59699 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Total vector size (bp) 5548
  • Vector type
    Bacterial Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
    XL1 Blue
  • Copy number


  • Gene/Insert name
    KDM4A double Tudor
  • Species
    H. sapiens (human)
  • Insert Size (bp)
  • Entrez Gene
    KDM4A (a.k.a. JHDM3A, JMJD2, JMJD2A, TDRD14A)
  • Promoter tac promoter
  • Tag / Fusion Protein
    • GST (N terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (unknown if destroyed)
  • 3′ cloning site XhoI (unknown if destroyed)
  • 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
  • 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
  • (Common Sequencing Primers)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

The discrepancies found in the QC sequence do not have any functional consequence.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGEX-GP-2-KDM4A double Tudor was a gift from Albert Jeltsch (Addgene plasmid # 59699 ; ; RRID:Addgene_59699)