pGEX-GP-2-KDM4A double Tudor
(Plasmid
#59699)
-
PurposeContains histone modification interacting domain (KDM4A double Tudor)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59699 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-6p-2
- Total vector size (bp) 5548
-
Vector typeBacterial Expression
-
Selectable markersAmpicilin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameKDM4A double Tudor
-
SpeciesH. sapiens (human)
-
Insert Size (bp)611
-
Entrez GeneKDM4A (a.k.a. JHDM3A, JMJD2, JMJD2A, TDRD14A)
- Promoter tac promoter
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The discrepancies found in the QC sequence do not have any functional consequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-GP-2-KDM4A double Tudor was a gift from Albert Jeltsch (Addgene plasmid # 59699 ; http://n2t.net/addgene:59699 ; RRID:Addgene_59699)