pGEX-GP-2-CBX1 Chromo
(Plasmid
#59697)
-
PurposeContains histone modification interacting domain (CBX1 Chromo)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59697 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-6p-2
- Total vector size (bp) 5141
-
Vector typeBacterial Expression
-
Selectable markersAmpicilin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCBX1 Chromo
-
Alt nameHP1 beta
-
SpeciesH. sapiens (human)
-
Insert Size (bp)204
-
Entrez GeneCBX1 (a.k.a. CBX, HP1-BETA, HP1Hs-beta, HP1Hsbeta, Hp1beta, M31, MOD1, p25beta)
- Promoter tac promoter
-
Tag
/ Fusion Protein
- GST (N terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The discrepancies found in the QC sequence do not have any functional consequence.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-GP-2-CBX1 Chromo was a gift from Albert Jeltsch (Addgene plasmid # 59697 ; http://n2t.net/addgene:59697 ; RRID:Addgene_59697) -
For your References section:
Application of histone modification-specific interaction domains as an alternative to antibodies. Kungulovski G, Kycia I, Tamas R, Jurkowska RZ, Kudithipudi S, Henry C, Reinhardt R, Labhart P, Jeltsch A. Genome Res. 2014 Nov;24(11):1842-53. doi: 10.1101/gr.170985.113. Epub 2014 Oct 9. 10.1101/gr.170985.113 PubMed 25301795