pGEX-GP-2-DNMT3A PWWP
(Plasmid
#59696)
-
PurposeContains histone modification interacting domain (DNMT3A PWWP)
-
Depositing Lab
-
Depositing OrganizationUniversitaet Stuttgart
Located in Germany -
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
Backbone
-
Vector backbonepGEX-6p-2
-
Backbone manufacturerGE Healthcare
- Total vector size (bp) 5395
-
Vector typeBacterial Expression
-
Selectable markersAmpicilin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDNMT3A PWWP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)458
-
Entrez GeneDnmt3a (a.k.a. MmuIIIA)
- Promoter tac promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: P144 is deleted, which has no functional consequences on the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-GP-2-DNMT3A PWWP was a gift from Albert Jeltsch (Addgene plasmid # 59696 ; http://n2t.net/addgene:59696 ; RRID:Addgene_59696) -
For your References section:
Application of histone modification-specific interaction domains as an alternative to antibodies. Kungulovski G, Kycia I, Tamas R, Jurkowska RZ, Kudithipudi S, Henry C, Reinhardt R, Labhart P, Jeltsch A. Genome Res. 2014 Nov;24(11):1842-53. doi: 10.1101/gr.170985.113. Epub 2014 Oct 9. 10.1101/gr.170985.113 PubMed 25301795