pGEX-GP-2-DNMT3A PWWP
(Plasmid
#59696)
-
PurposeContains histone modification interacting domain (DNMT3A PWWP)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59696 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGEX-6p-2
-
Backbone manufacturerGE Healthcare
- Total vector size (bp) 5395
-
Vector typeBacterial Expression
-
Selectable markersAmpicilin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDNMT3A PWWP
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)458
-
Entrez GeneDnmt3a (a.k.a. MmuIIIA)
- Promoter tac promoter
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (unknown if destroyed)
- 3′ cloning site XhoI (unknown if destroyed)
- 5′ sequencing primer GGGCTGGCAAGCCACGTTTGGTG
- 3′ sequencing primer CCGGGAGCTGCATGTGTCAGAGG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Note: P144 is deleted, which has no functional consequences on the plasmid.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGEX-GP-2-DNMT3A PWWP was a gift from Albert Jeltsch (Addgene plasmid # 59696 ; http://n2t.net/addgene:59696 ; RRID:Addgene_59696)