Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET14b_tev_PSG
(Plasmid #59731)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59731 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET14b_TEV
  • Backbone manufacturer
    EMD Millipore
  • Backbone size w/o insert (bp) 4670
  • Total vector size (bp) 5905
  • Modifications to backbone
    Thrombin cleavage site of pET14b replaced by TEV protease cleavage site.
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    See primary reference
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    TJP1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1235
  • Entrez Gene
    TJP1 (a.k.a. ZO-1)
  • Tags / Fusion Proteins
    • HIS (N terminal on insert)
    • TEV (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Nde I (not destroyed)
  • 3′ cloning site Bam HI (not destroyed)
  • 5′ sequencing primer T7 fwd
  • 3′ sequencing primer CACCCGTCCTGTGGATATCCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET14b_tev_PSG was a gift from Alan Fanning (Addgene plasmid # 59731 ; http://n2t.net/addgene:59731 ; RRID:Addgene_59731)
  • For your References section:

    The Src homology 3 domain is required for junctional adhesion molecule binding to the third PDZ domain of the scaffolding protein ZO-1. Nomme J, Fanning AS, Caffrey M, Lye MF, Anderson JM, Lavie A. J Biol Chem. 2011 Dec 16;286(50):43352-60. doi: 10.1074/jbc.M111.304089. Epub 2011 Oct 26. 10.1074/jbc.M111.304089 PubMed 22030391