pET14b_tev_PSG
(Plasmid
#59731)
-
PurposeExpresses PDZ3-SH3-GUK fragment of human ZO-1 in bacteria
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59731 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepET14b_TEV
-
Backbone manufacturerEMD Millipore
- Backbone size w/o insert (bp) 4670
- Total vector size (bp) 5905
-
Modifications to backboneThrombin cleavage site of pET14b replaced by TEV protease cleavage site.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsSee primary reference
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameTJP1
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1235
-
Entrez GeneTJP1 (a.k.a. ZO-1)
-
Tags
/ Fusion Proteins
- HIS (N terminal on insert)
- TEV (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Nde I (not destroyed)
- 3′ cloning site Bam HI (not destroyed)
- 5′ sequencing primer T7 fwd
- 3′ sequencing primer CACCCGTCCTGTGGATATCCG (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pET14b_tev_PSG was a gift from Alan Fanning (Addgene plasmid # 59731 ; http://n2t.net/addgene:59731 ; RRID:Addgene_59731) -
For your References section:
The Src homology 3 domain is required for junctional adhesion molecule binding to the third PDZ domain of the scaffolding protein ZO-1. Nomme J, Fanning AS, Caffrey M, Lye MF, Anderson JM, Lavie A. J Biol Chem. 2011 Dec 16;286(50):43352-60. doi: 10.1074/jbc.M111.304089. Epub 2011 Oct 26. 10.1074/jbc.M111.304089 PubMed 22030391