Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more


(Plasmid #59746)


This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 59746 Standard format: Plasmid sent in bacteria as agar stab 1 $85


  • Vector backbone
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
  • Growth Strain(s)
    XL10 Gold
  • Copy number
    High Copy


  • Gene/Insert name
  • Species
    M. musculus (mouse)
  • Promoter CMV and T7
  • Tag / Fusion Protein
    • EGFP (N terminal on insert)

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer CACTGCTTACTGGCTTATCG
  • 3′ sequencing primer CCAAACTTTTATTTGTGCACAT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pcDNA-EGFP-ELYS-polyA was a gift from Yi Zhang (Addgene plasmid # 59746 ; ; RRID:Addgene_59746)
  • For your References section:

    Nucleosome assembly is required for nuclear pore complex assembly in mouse zygotes. Inoue A, Zhang Y. Nat Struct Mol Biol. 2014 Jul;21(7):609-16. doi: 10.1038/nsmb.2839. Epub 2014 Jun 8. 10.1038/nsmb.2839 PubMed 24908396