-
PurposeGenetically encoded fluorescent voltage indicator
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 59800 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCAG
-
Backbone manufacturerCustom
- Backbone size w/o insert (bp) 4796
- Total vector size (bp) 6794
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameCyan-Yellow Chimeric Butterfly Voltage Sensitive Fluorescent Protein
-
Alt nameVSFP
-
SpeciesSynthetic
-
Insert Size (bp)1983
- Promoter CAG
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NheI (unknown if destroyed)
- 3′ cloning site AflII (unknown if destroyed)
- 5′ sequencing primer ttcggcttctggcgtgtgacc
- 3′ sequencing primer tagccagaagtcagatgctcaagG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-Chimeric_Butterfly_CY_1.0 was a gift from Thomas Knopfel (Addgene plasmid # 59800 ; http://n2t.net/addgene:59800 ; RRID:Addgene_59800) -
For your References section:
Exploration of genetically encoded voltage indicators based on a chimeric voltage sensing domain. Mishina Y, Mutoh H, Song C, Knopfel T. Front Mol Neurosci. 2014 Sep 29;7:78. doi: 10.3389/fnmol.2014.00078. eCollection 2014. 10.3389/fnmol.2014.00078 PubMed 25324718