Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pBbE1k-2
(Plasmid #59945)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 59945 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pBbE1k
  • Backbone size w/o insert (bp) 3550
  • Total vector size (bp) 4598

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH10B
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    dihydropterine reductase
  • Alt name
    DHPR
  • Insert Size (bp)
    734
  • Promoter pTrc

Cloning Information for Gene/Insert 1

  • Cloning method Unknown
  • 5′ sequencing primer AACTATCCGCTGGATGACCA
  • 3′ sequencing primer CGTTCTTTCGGTAGGTCAAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    pterin-4a-carbinolamine dehydratase
  • Alt name
    PCD
  • Insert Size (bp)
    314
  • Promoter pTrc

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer AACTATCCGCTGGATGACCA
  • 3′ sequencing primer CGTTCTTTCGGTAGGTCAAA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBbE1k-2 was a gift from Taek Soon Lee (Addgene plasmid # 59945 ; http://n2t.net/addgene:59945 ; RRID:Addgene_59945)
  • For your References section:

    Engineering of L-tyrosine oxidation in Escherichia coli and microbial production of hydroxytyrosol. Satoh Y, Tajima K, Munekata M, Keasling JD, Lee TS. Metab Eng. 2012 Nov;14(6):603-10. doi: 10.1016/j.ymben.2012.08.002. Epub 2012 Aug 29. 10.1016/j.ymben.2012.08.002 PubMed 22948011