U6>sgRNA(F+E)
(Plasmid
#59986)
-
Purpose(Empty Backbone) Empty vector for sgRNA cloning (F+E modified backbone)
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 59986 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCESAx
-
Modifications to backboneMutated BsaI sites in backbone
-
Vector typeCRISPR
- Promoter Ciinte.U6
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberUnknown
Cloning Information
- 5′ sequencing primer cccaagcgagtgtttgttac
- 3′ sequencing primer GGATTTCCTTACGCGAAATACG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
U6 promoter based on Nishiyama, A. and Fujiwara, S. (2008). RNA interference by expressing short hairpin RNA in the Ciona intestinalis embryo. Dev. growth … 521–529.
sgRNA F+E scaffold based on Chen, B., Gilbert, L. a, Cimini, B. a, Schnitzbauer, J., Zhang, W., Li, G.-W., Park, J., Blackburn, E. H., Weissman, J. S., Qi, L. S., et al. (2013). Dynamic imaging of genomic loci in living human cells by an optimized CRISPR/Cas system. Cell 155, 1479–91.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
U6>sgRNA(F+E) was a gift from Lionel Christiaen (Addgene plasmid # 59986 ; http://n2t.net/addgene:59986 ; RRID:Addgene_59986) -
For your References section:
Tissue-specific genome editing in Ciona embryos by CRISPR/Cas9. Stolfi A, Gandhi S, Salek F, Christiaen L. Development. 2014 Nov;141(21):4115-20. doi: 10.1242/dev.114488. 10.1242/dev.114488 PubMed 25336740