-
PurposeIPTG-inducible expression of Transposon Tn5 fused to Mxe Intein and Chitin-binding domain.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60240 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTXB1
-
Backbone manufacturerNew England Biolabs
- Backbone size w/o insert (bp) 6706
- Total vector size (bp) 8079
-
Modifications to backboneNone
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)XL1 Blue
-
Growth instructionsGrowth at 37°C before IPTG induction. After IPTG addition, grow at 30°C. The depositing laboratory recommends E. coli strains NEB C3013 or ER2566 for protein expression.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nametnpA from pBam1
-
Alt nameTn5 transposase
-
SpeciesE. coli
-
Insert Size (bp)1428
-
MutationE54K, L372P
-
GenBank IDHQ908071.1
- Promoter T7 promoter
-
Tag
/ Fusion Protein
- Mxe intein - Chitin-binding domain (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xba (not destroyed)
- 3′ cloning site Lgu1/SapI) (destroyed during cloning)
- 5′ sequencing primer T7 promoter primer
- 3′ sequencing primer GATTGCCATGCCGGTCAAGG
- (Common Sequencing Primers)
Resource Information
-
Addgene Notes
-
A portion of this plasmid was derived from a plasmid made byTn5 transposase from pBAM1 (Addgene Plasmid #60487)
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTXB1-Tn5 was a gift from Rickard Sandberg (Addgene plasmid # 60240 ; http://n2t.net/addgene:60240 ; RRID:Addgene_60240) -
For your References section:
Tn5 transposase and tagmentation procedures for massively-scaled sequencing projects. Picelli S, Bjorklund AK, Reinius B, Sagasser S, Winberg G, Sandberg R. Genome Res. 2014 Jul 30. pii: gr.177881.114. 10.1101/gr.177881.114 PubMed 25079858