Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pGL2 HNF4A P2 wt
(Plasmid #60324)

Loading...

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60324 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGL2-basic
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 5598
  • Vector type
    Mammalian Expression, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    NM_000457.4
  • Species
    H. sapiens (human)
  • Entrez Gene
    HNF4A (a.k.a. FRTS4, HNF4, HNF4a7, HNF4a8, HNF4a9, HNF4alpha, MODY, MODY1, NR2A1, NR2A21, TCF, TCF-14, TCF14)
  • Tag / Fusion Protein
    • Luciferase (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (not destroyed)
  • 3′ cloning site Unknown (not destroyed)
  • 5′ sequencing primer GLprimer2 (Promega): CTTTATGTTTTTGGCGTCTTCCA
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

–371 to –37 from HNF4A TSS

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGL2 HNF4A P2 wt was a gift from Jorge Ferrer (Addgene plasmid # 60324 ; http://n2t.net/addgene:60324 ; RRID:Addgene_60324)
  • For your References section:

    Genetic evidence that HNF-1alpha-dependent transcriptional control of HNF-4alpha is essential for human pancreatic beta cell function. Hansen SK, Parrizas M, Jensen ML, Pruhova S, Ek J, Boj SF, Johansen A, Maestro MA, Rivera F, Eiberg H, Andel M, Lebl J, Pedersen O, Ferrer J, Hansen T. J Clin Invest. 2002 Sep;110(6):827-33. 10.1172/JCI15085 PubMed 12235114