-
PurposeLentiviral vector with CaMKIIa promoter and upstream CMV promoter expressing Archer1-EGFP fusion. Archer1's red fluorescence monitors changes in membrane voltage.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60423 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti
- Backbone size w/o insert (bp) 9241
- Total vector size (bp) 10843
-
Vector typeMammalian Expression, Lentiviral
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Growth instructionsUse recombinase-free E. coli
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameArcher1-EGFP
-
Alt nameArchDETC
-
SpeciesH. sodomense
-
Insert Size (bp)1602
- Promoter CaMKIIa
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer TTCTCCGTTTGCACTCAGGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThis plasmid backbone containing wild-type Arch and a different fusion protein (pLenti-CaMKIIa-eArch 3.0-EYFP) was deposited at Addgene by the Deisseroth lab.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti-CaMKIIa-Archer1-EGFP was a gift from Viviana Gradinaru (Addgene plasmid # 60423 ; http://n2t.net/addgene:60423 ; RRID:Addgene_60423) -
For your References section:
Archaerhodopsin variants with enhanced voltage-sensitive fluorescence in mammalian and Caenorhabditis elegans neurons. Flytzanis NC, Bedbrook CN, Chiu H, Engqvist MK, Xiao C, Chan KY, Sternberg PW, Arnold FH, Gradinaru V. Nat Commun. 2014 Sep 15;5:4894. doi: 10.1038/ncomms5894. 10.1038/ncomms5894 PubMed 25222271