Skip to main content

pLenti-CaMKIIa-Archer1-EGFP
(Plasmid #60423)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60423 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLenti
  • Backbone size w/o insert (bp) 9241
  • Total vector size (bp) 10843
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    Use recombinase-free E. coli
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Archer1-EGFP
  • Alt name
    ArchDETC
  • Species
    H. sodomense
  • Insert Size (bp)
    1602
  • Promoter CaMKIIa
  • Tag / Fusion Protein
    • EGFP (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer TTCTCCGTTTGCACTCAGGAGC
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    This plasmid backbone containing wild-type Arch and a different fusion protein (pLenti-CaMKIIa-eArch 3.0-EYFP) was deposited at Addgene by the Deisseroth lab.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLenti-CaMKIIa-Archer1-EGFP was a gift from Viviana Gradinaru (Addgene plasmid # 60423 ; http://n2t.net/addgene:60423 ; RRID:Addgene_60423)
  • For your References section:

    Archaerhodopsin variants with enhanced voltage-sensitive fluorescence in mammalian and Caenorhabditis elegans neurons. Flytzanis NC, Bedbrook CN, Chiu H, Engqvist MK, Xiao C, Chan KY, Sternberg PW, Arnold FH, Gradinaru V. Nat Commun. 2014 Sep 15;5:4894. doi: 10.1038/ncomms5894. 10.1038/ncomms5894 PubMed 25222271