Skip to main content

LeGO-iG2-wPRE-pA
(Plasmid #60489)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60489 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    LeGO
  • Total vector size (bp) 8076
  • Modifications to backbone
    Insertion of BGH-pA (polyadenylation-signal of bovine growth hormone)into PvuII-site of previously described LeGO-iG2. BGH-pA-fragment was generated by PCR using the following primer (u58-fw: GCTGTACAAGTAACTGTGCCTTCTAG and u59-rev: GCTGTACAGCCATAGAGCCCAC).
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    any (like TOP10, XL10-Gold or Stbl)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    IRES-eGFP; wPRE; BGH-pA

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    As template for BGH-pA-PCR the previously described pAC_CMV_TALE_RM1_long_FokI_1317 was used (Mussolino, C. et al. A novel TALE nuclease scaffold enables high genome editing activity in combination with low toxicity. Nucleic Acids Res.39,9283–9293 (2011))

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LeGO-iG2-wPRE-pA was a gift from Boris Fehse (Addgene plasmid # 60489 ; http://n2t.net/addgene:60489 ; RRID:Addgene_60489)
  • For your References section:

    Novel lentiviral vectors with mutated reverse transcriptase for mRNA delivery of TALE nucleases. Mock U, Riecken K, Berdien B, Qasim W, Chan E, Cathomen T, Fehse B. Sci Rep. 2014 Sep 18;4:6409. doi: 10.1038/srep06409. 10.1038/srep06409 PubMed 25230987