This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

dRT-pMDLg/pRRE
(Plasmid #60488)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60488 Standard format: Plasmid sent in bacteria as agar stab 1 $65

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pMDLg/pRRE
  • Backbone manufacturer
    Didier Trono
  • Total vector size (bp) 8895
  • Modifications to backbone
    dRT-pMDLg/pRRE was generated by megaprimer-PCR on previously described pMDLg/pRRE using primer u44 (fw: ACAATGAGACACCA), u45 (rev: GATATGTCCATTGGCCTTGCCC) and u46 (RT-mtagenesis-rev: TACATACAACACCACCATGTAT) to mutate the active centre of the reverse transcriptase by replacing YMDD by YMVV.

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Growth instructions
    any (like TOP10, XL10-Gold or Stbl)
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    HIV-1 gag, HIV-1 pol with inactive reverse transcriptase
  • Alt name
    dRT-gag/pol
  • Mutation
    changed Asp at position 249 + 250 to Val

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    dRT-pMDLg/pRRE was a gift from Boris Fehse (Addgene plasmid # 60488 ; http://n2t.net/addgene:60488 ; RRID:Addgene_60488)
  • For your References section:

    Novel lentiviral vectors with mutated reverse transcriptase for mRNA delivery of TALE nucleases. Mock U, Riecken K, Berdien B, Qasim W, Chan E, Cathomen T, Fehse B. Sci Rep. 2014 Sep 18;4:6409. doi: 10.1038/srep06409. 10.1038/srep06409 PubMed 25230987