dRT-pMDLg/pRRE
(Plasmid #60488)

• Purpose: gag/pol packaging plasmid for production of lentiviral vectors with mutated reverse transcriptase (NRTLV, non-reverse transcribable lentiviral vectors)
• Depositing Lab: Boris Fehse
• Publication: Mock et al Sci Rep. 2014 Sep 18;4:6409. doi: 10.1038/srep06409.

Backbone

• Vector backbone: pMDLg/pRRE
• Backbone manufacturer: Didier Trono
• Total vector size (bp): 8895
• Modifications to backbone: dRT-pMDLg/pRRE was generated by megaprimer-PCR on previously described pMDLg/pRRE using primer u44 (fw: ACAATGAGACACCA), u45 (rev: GATATGTCCATTGGCCTTGCCC) and u46 (RT-mtagenesis-rev: TACATACAACACCACCATGTAT) to mutate the active centre of the reverse transcriptase by replacing YMDD by YMVV.

Growth in Bacteria

• Bacterial Resistance(s): Ampicillin, 100 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): Stbl3
• Growth instructions: any (like TOP10, XL10-Gold or Stbl)
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: HIV-1 gag, HIV-1 pol with inactive reverse transcriptase
• Alt name: dRT-gag/pol
• Mutation: changed Asp at position 249 + 250 to Val

Resource Information

• A portion of this plasmid was derived from a plasmid made by: The initial backbone pMDLg/pRRE was created by Didier Trono (Addgene Plasmid #12251)
• Articles Citing this Plasmid:
  • 6 References

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry