Skip to main content

LV-Floxed Luc
(Plasmid #60622)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60622 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FUGW
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 12927
  • Vector type
    Lentiviral, Cre/Lox, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Floxed Luciferase
  • Promoter human UbC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gttggcgagtgtgttttgtg
  • 3′ sequencing primer TGACAACGGGCCACAACTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LV-Floxed Luc was a gift from Charles Gersbach (Addgene plasmid # 60622 ; http://n2t.net/addgene:60622 ; RRID:Addgene_60622)
  • For your References section:

    Enhanced MyoD-Induced Transdifferentiation to a Myogenic Lineage by Fusion to a Potent Transactivation Domain. Kabadi AM, Thakore PI, Vockely CM, Ousterout DG, Gibson TM, Guilak F, Reddy TE, Gersbach CA. ACS Synth Biol. 2014 Dec 10. 10.1021/sb500322u PubMed 25494287