Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

LV-Floxed Luc
(Plasmid #60622)


Item Catalog # Description Quantity Price (USD)
Plasmid 60622 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size w/o insert (bp) 10000
  • Total vector size (bp) 12927
  • Vector type
    Lentiviral, Cre/Lox, Luciferase

Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number
    High Copy


  • Gene/Insert name
    Floxed Luciferase
  • Promoter human UbC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer gttggcgagtgtgttttgtg
  • 3′ sequencing primer TGACAACGGGCCACAACTCC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    LV-Floxed Luc was a gift from Charles Gersbach (Addgene plasmid # 60622 ; ; RRID:Addgene_60622)
  • For your References section:

    Enhanced MyoD-Induced Transdifferentiation to a Myogenic Lineage by Fusion to a Potent Transactivation Domain. Kabadi AM, Thakore PI, Vockely CM, Ousterout DG, Gibson TM, Guilak F, Reddy TE, Gersbach CA. ACS Synth Biol. 2014 Dec 10. 10.1021/sb500322u PubMed 25494287