-
PurposeExpresses VP64 human MyoD and dsRedExpress2 in response to doxycycline
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60629 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepRRL
- Backbone size w/o insert (bp) 10000
- Total vector size (bp) 11241
-
Vector typeLentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameVP64 human MyoD
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1230
-
GenBank ID
-
Entrez GeneMYOD1 (a.k.a. CMYP17, MYF3, MYOD, MYODRIF, PUM, bHLHc1)
- Promoter TRE
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NsiI (not destroyed)
- 3′ cloning site NsiI (not destroyed)
- 5′ sequencing primer tacggtgggaggcctatataagca
- 3′ sequencing primer TCTGGGTGCCCTCGTAGGGCTT (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
LV-TRE-VP64 human MyoD-T2A-dsRedExpress2 was a gift from Charles Gersbach (Addgene plasmid # 60629 ; http://n2t.net/addgene:60629 ; RRID:Addgene_60629) -
For your References section:
Enhanced MyoD-Induced Transdifferentiation to a Myogenic Lineage by Fusion to a Potent Transactivation Domain. Kabadi AM, Thakore PI, Vockely CM, Ousterout DG, Gibson TM, Guilak F, Reddy TE, Gersbach CA. ACS Synth Biol. 2014 Dec 10. 10.1021/sb500322u PubMed 25494287