pUCXKT
(Plasmid
#60682)
-
Purpose(Empty Backbone) positive selection cloning and expression vector
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60682 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepUC19
-
Vector typeBacterial Expression ; positive selection E. coli expression vector
- Promoter tac
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsAll temps fine, plasmid gains KanR when appropriate insert cloned, as per Prosser et al, Biotechnology Letters (2014)
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer GGCTCGTATAATGTGTGG
- 3′ sequencing primer GACCGCTTCTGCGTTCTGAT (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pUCXKT was a gift from David Ackerley (Addgene plasmid # 60682 ; http://n2t.net/addgene:60682 ; RRID:Addgene_60682) -
For your References section:
A gain-of-function positive-selection expression plasmid that enables high-efficiency cloning. Prosser GA, Williams EM, Sissons JA, Walmsley KE, Parker MR, Ackerley DF. Biotechnol Lett. 2014 Sep 26. 10.1007/s10529-014-1673-4 PubMed 25257589