- 
            Purpose3rd generation vector. Expresses a sgRNA of interest, Cas9 and Cre
- 
              Depositing Lab
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 60820 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepLL3.3
- Backbone size w/o insert (bp) 5878
- Total vector size (bp) 13956
- 
              Vector typeMammalian Expression, Mouse Targeting, Lentiviral, Cre/Lox, CRISPR
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature30°C
- 
            Growth Strain(s)Stbl3
- 
            Copy numberUnknown
Gene/Insert 1
- 
                Gene/Insert nameCas9
- 
                  Alt namehSpCsn1
- 
                    SpeciesS. pyogenes
- 
                  Insert Size (bp)4101
- Promoter EFS
- 
    
        Tag
        / Fusion Protein
    - Flag (N terminal on insert)
 
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer GACCCGACATTAGCGCTACAG
- 3′ sequencing primer GCCGCTGCCGCTAGCTTTCTT (Common Sequencing Primers)
Gene/Insert 2
- 
                Gene/Insert nameCre
- 
                  Insert Size (bp)1029
- 
                  MutationBsmBI site eliminated by C->A; E308G
- Promoter EFS (after Cas9-2A)
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer GCCACCAACTTCAGCCTGCTG
- 3′ sequencing primer CAACCCCAAACAACAACGTTT (Common Sequencing Primers)
Resource Information
- 
            
            
            Supplemental Documents
- 
            A portion of this plasmid was derived from a plasmid made byCas9 gene cloned from LentiCRISPR
- 
            Articles Citing this Plasmid
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pSECC was a gift from Tyler Jacks (Addgene plasmid # 60820 ; http://n2t.net/addgene:60820 ; RRID:Addgene_60820)
- 
                For your References section: Rapid modelling of cooperating genetic events in cancer through somatic genome editing. Sanchez-Rivera FJ, Papagiannakopoulos T, Romero R, Tammela T, Bauer MR, Bhutkar A, Joshi NS, Subbaraj L, Bronson RT, Xue W, Jacks T. Nature. 2014 Oct 22. doi: 10.1038/nature13906. 10.1038/nature13906 PubMed 25337879
 
    
 
                         
             
            