Skip to main content

NaChBac pTracer CMV2
(Plasmid #60835)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 60835 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    Modified pTracer™-CMV2
  • Backbone size w/o insert (bp) 6210
  • Total vector size (bp) 6500
  • Vector type
    Mammalian Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NaChBac
  • Alt name
    NavBh
  • Species
    Bacillus Hallodurans C-125
  • Insert Size (bp)
    825
  • GenBank ID
    NP_242367.1
  • Promoter CMV

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer CGC AAA TGG GCG GTA GGC GTG
  • 3′ sequencing primer CACGCCTACCGCCCATTTGCG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

NOTE: The EGFP in this plasmid does has some discrepancies with the EGFP reported in the standard pTracer™-CMV2. These modifications do not appear to change the function or effectivity of the EGFP.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    NaChBac pTracer CMV2 was a gift from David Clapham (Addgene plasmid # 60835 ; http://n2t.net/addgene:60835 ; RRID:Addgene_60835)
  • For your References section:

    A prokaryotic voltage-gated sodium channel. Ren D, Navarro B, Xu H, Yue L, Shi Q, Clapham DE. Science. 2001 Dec 14;294(5550):2372-5. 10.1126/science.1065635 PubMed 11743207