NaChBac pTracer CMV2
(Plasmid
#60835)
-
PurposeMammalian expression plasmid containing NaChBac gene with an EGFP reporter
-
Depositing Lab
-
Publication
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60835 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backboneModified pTracer™-CMV2
- Backbone size w/o insert (bp) 6210
- Total vector size (bp) 6500
-
Vector typeMammalian Expression
-
Selectable markersGentamicin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameNaChBac
-
Alt nameNavBh
-
SpeciesBacillus Hallodurans C-125
-
Insert Size (bp)825
-
GenBank IDNP_242367.1
- Promoter CMV
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer CGC AAA TGG GCG GTA GGC GTG
- 3′ sequencing primer CACGCCTACCGCCCATTTGCG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
NOTE: The EGFP in this plasmid does has some discrepancies with the EGFP reported in the standard pTracer™-CMV2. These modifications do not appear to change the function or effectivity of the EGFP.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
NaChBac pTracer CMV2 was a gift from David Clapham (Addgene plasmid # 60835 ; http://n2t.net/addgene:60835 ; RRID:Addgene_60835) -
For your References section:
A prokaryotic voltage-gated sodium channel. Ren D, Navarro B, Xu H, Yue L, Shi Q, Clapham DE. Science. 2001 Dec 14;294(5550):2372-5. 10.1126/science.1065635 PubMed 11743207