-
Purpose2nd generation lentiviral transfer plasmid. Expresses a synthetic cluster of miR-9/9* and miR-124 fused to Bcl-xL under a doxycycline-inducible promoter
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60857 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTLemiR
-
Backbone manufacturerHomemade
- Backbone size w/o insert (bp) 10335
- Total vector size (bp) 11706
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemiR-9/9*-miR-124-BCLxL
-
Alt namemicroRNA 9, microRNA 124, BCL2-like 1
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)1371
-
GenBank IDNR_029818 NR_029814 NM_138578.1
-
Entrez GeneBCL2L1 (a.k.a. BCL-XL/S, BCL2L, BCLX, Bcl-X, PPP1R52)
- Promoter pTight
Cloning Information
- Cloning method Ligation Independent Cloning
- 5′ sequencing primer AGCGCTGCCACCATGTCTCA
- 3′ sequencing primer GCACACCGGCCTTATTCCAAG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTight-9-124-BclxL was a gift from Andrew Yoo (Addgene plasmid # 60857 ; http://n2t.net/addgene:60857 ; RRID:Addgene_60857) -
For your References section:
Generation of Human Striatal Neurons by MicroRNA-Dependent Direct Conversion of Fibroblasts. Victor MB, Richner M, Hermanstyne TO, Ransdell JL, Sobieski C, Deng PY, Klyachko VA, Nerbonne JM, Yoo AS. Neuron. 2014 Oct 22;84(2):311-23. doi: 10.1016/j.neuron.2014.10.016. Epub 2014 Oct 22. 10.1016/j.neuron.2014.10.016 PubMed 25374357