Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

phDLX2-N174
(Plasmid #60860)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 60860 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    N174
  • Backbone manufacturer
    Homemade
  • Backbone size w/o insert (bp) 8865
  • Total vector size (bp) 9852
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    DLX2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    987
  • GenBank ID
    NM_004405.3
  • Entrez Gene
    DLX2 (a.k.a. TES-1, TES1)
  • Promoter EF1a

Cloning Information

  • Cloning method Ligation Independent Cloning
  • 5′ sequencing primer GGCACTTGATGTAATTCTCCTTG
  • 3′ sequencing primer GTGGATGTGGAATGTGTGCGA
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    phDLX2-N174 was a gift from Andrew Yoo (Addgene plasmid # 60860 ; http://n2t.net/addgene:60860 ; RRID:Addgene_60860)
  • For your References section:

    Generation of Human Striatal Neurons by MicroRNA-Dependent Direct Conversion of Fibroblasts. Victor MB, Richner M, Hermanstyne TO, Ransdell JL, Sobieski C, Deng PY, Klyachko VA, Nerbonne JM, Yoo AS. Neuron. 2014 Oct 22;84(2):311-23. doi: 10.1016/j.neuron.2014.10.016. Epub 2014 Oct 22. 10.1016/j.neuron.2014.10.016 PubMed 25374357