-
PurposeConstitutive expression vector for Cre-recombinase containing URA3 selection marker.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 60930 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepSH47
-
Vector typeYeast Expression
-
Selectable markersURA3
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCre
-
Alt nameCre-recombinase
-
SpeciesE. coli
-
Insert Size (bp)1032
- Promoter mutant TEF1
-
Tag
/ Fusion Protein
- Driven from a mutant TEF1 promoter with 0.16x activity
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer cgataccgtcgaggggcagagcc
- 3′ sequencing primer catattttccgtcgatgttgaaatcc (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThey were gene synthesized using a commercial service, which made them according to our design.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pPL5071_TEF1*-Cre_URA3 was a gift from Robert Piper (Addgene plasmid # 60930 ; http://n2t.net/addgene:60930 ; RRID:Addgene_60930) -
For your References section:
Puromycin and Methotrexate Resistance Cassettes and Optimized cre-recombinase Expression Plasmids for use in Yeast. MacDonald C, Piper RC. Yeast. 2015 Feb 16. doi: 10.1002/yea.3069. 10.1002/yea.3069 PubMed 25688547