-
Purposefor generation of a eGFP specific sgRNA from a T7 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61051 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneDR274
-
Backbone manufacturerJoung Lab, Addgene plasmid # 42250
-
Vector typeCRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEGFP sgRNA
-
SpeciesSynthetic
- Promoter T7
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer M13 (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
eGFP sgRNA = GGCGAGGGCGATGCCACCTA
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
DR274-eGFP sgRNA was a gift from Filippo Del Bene (Addgene plasmid # 61051 ; http://n2t.net/addgene:61051 ; RRID:Addgene_61051) -
For your References section:
Highly efficient CRISPR/Cas9-mediated knock-in in zebrafish by homology-independent DNA repair. Auer TO, Duroure K, De Cian A, Concordet JP, Del Bene F. Genome Res. 2014 Jan;24(1):142-53. doi: 10.1101/gr.161638.113. Epub 2013 Oct 31. 10.1101/gr.161638.113 PubMed 24179142