gRNA-hIRF-1 #12/pSIR
(Plasmid
#61080)
-
PurposeExpresses a guide RNA (gRNA) to target human IRF-1 promoter
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61080 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSIR
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 8083
- Total vector size (bp) 8638
-
Vector typeMammalian Expression, Retroviral, CRISPR
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namegRNA_hIRF1 promoter #12
-
SpeciesH. sapiens (human)
-
Insert Size (bp)555
-
GenBank IDDQ789232.1
-
Entrez GeneIRF1 (a.k.a. IMD117, IRF-1, MAR)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Xho I (not destroyed)
- 3′ cloning site Hind III (not destroyed)
- 5′ sequencing primer ATACTGGCCGTTCTCCTCTTCTGA
- 3′ sequencing primer GCGCTTACACTTTAGGAGACACTC (Common Sequencing Primers)
Resource Information
-
Addgene Notes
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
gRNA-hIRF-1 #12/pSIR was a gift from Hodaka Fujii (Addgene plasmid # 61080 ; http://n2t.net/addgene:61080 ; RRID:Addgene_61080) -
For your References section:
Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. Fujita T, Fujii H. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. 10.1371/journal.pone.0103084 PubMed 25051498