Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

gRNA-hIRF-1 #12/pSIR
(Plasmid #61080)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61080 Standard format: Plasmid sent in bacteria as agar stab 1 $85

Backbone

  • Vector backbone
    pSIR
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 8083
  • Total vector size (bp) 8638
  • Vector type
    Mammalian Expression, Retroviral, CRISPR
  • Selectable markers
    Neomycin (select with G418)

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    gRNA_hIRF1 promoter #12
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    555
  • GenBank ID
    DQ789232.1
  • Entrez Gene
    IRF1 (a.k.a. IMD117, IRF-1, MAR)
  • Promoter U6

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site Xho I (not destroyed)
  • 3′ cloning site Hind III (not destroyed)
  • 5′ sequencing primer ATACTGGCCGTTCTCCTCTTCTGA
  • 3′ sequencing primer GCGCTTACACTTTAGGAGACACTC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

gRNA target sequence: CCGGGGGCGCTGGGCTGTCCCGG

For more information on Fujii Lab CRISPR Plasmids please refer to: http://www.addgene.org/crispr/fujii/

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    gRNA-hIRF-1 #12/pSIR was a gift from Hodaka Fujii (Addgene plasmid # 61080 ; http://n2t.net/addgene:61080 ; RRID:Addgene_61080)
  • For your References section:

    Identification of Proteins Associated with an IFNgamma-Responsive Promoter by a Retroviral Expression System for enChIP Using CRISPR. Fujita T, Fujii H. PLoS One. 2014 Jul 22;9(7):e103084. doi: 10.1371/journal.pone.0103084. eCollection 2014. 10.1371/journal.pone.0103084 PubMed 25051498