-
PurposeExpresses REX-GECO1 in neurons
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61248 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepAAV
- Backbone size w/o insert (bp) 4560
- Total vector size (bp) 5814
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH10B
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameREX-GECO1
-
Alt nameRed excitation ratiometric genetically encoded Ca2+-indicators for optical version 1
-
SpeciesSynthetic
-
Insert Size (bp)1254
-
MutationSubstitutions relative to R-GECO1: P60R, V61W, R66W, E77V, K80E, K97R, S142P, D147V, E148G, P220L, N257I, A302P, M339L, T382S
-
GenBank IDKP091743
- Promoter hSyn
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamH1 (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer GAGGAGTCGTGTCGTGCC
- 3′ sequencing primer CATAGCGTAAAAGGAGCAACA (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
The construct is numbered based on GCaMP.
There are 2 mismatches between Addgene's sequence and the provided reference sequence. These should not affect plasmid function.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
AAV-hSyn-REX-GECO1 was a gift from Robert Campbell (Addgene plasmid # 61248 ; http://n2t.net/addgene:61248 ; RRID:Addgene_61248) -
For your References section:
A long Stokes shift red fluorescent Ca(2+) indicator protein for two-photon and ratiometric imaging. Wu J, Abdelfattah AS, Miraucourt LS, Kutsarova E, Ruangkittisakul A, Zhou H, Ballanyi K, Wicks G, Drobizhev M, Rebane A, Ruthazer ES, Campbell RE. Nat Commun. 2014 Oct 31;5:5262. doi: 10.1038/ncomms6262. 10.1038/ncomms6262 PubMed 25358432