-
PurposeCRISPR/Cas9 plasmid with sgRNA(F+E) targeting pha-1; for co-conversion in C. elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61252 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepJW1219
-
Backbone manufacturerJordan Ward
- Backbone size w/o insert (bp) 8146
- Total vector size (bp) 8146
-
Modifications to backboneReplaced the sgRNA target sequence in the backbone with a sequence targeting the pha-1 locus near the e2123 allele.
-
Vector typeWorm Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA(F+E) targeting pha-1
-
SpeciesSynthetic
-
Insert Size (bp)123
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
Target sequence: atgaataacttgatgaacat
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1285 was a gift from Jordan Ward (Addgene plasmid # 61252 ; http://n2t.net/addgene:61252 ; RRID:Addgene_61252) -
For your References section:
Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Ward JD. Genetics. 2014 Dec 9. pii: genetics.114.172361. 10.1534/genetics.114.172361 PubMed 25491644