Skip to main content

pJW1311
(Plasmid #61254)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61254 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCR-Blunt II-TOPO
  • Backbone manufacturer
    Invitrogen
  • Backbone size w/o insert (bp) 3519
  • Total vector size (bp) 4162
  • Vector type
    CRISPR ; Cloning template

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    sgRNA(F+E) targeting Y61A9L9.1
  • Species
    Synthetic
  • Insert Size (bp)
    643
  • GenBank ID

Cloning Information

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    U6 promoter was subcloned from pDD162 (AddGene plasmid #47549) and provided by the Goldstein lab.
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

target sequence: gaacgaggctgaaaccctga

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pJW1311 was a gift from Jordan Ward (Addgene plasmid # 61254 ; http://n2t.net/addgene:61254 ; RRID:Addgene_61254)
  • For your References section:

    Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Ward JD. Genetics. 2014 Dec 9. pii: genetics.114.172361. 10.1534/genetics.114.172361 PubMed 25491644