-
PurposeTemplate for cloning sgRNA(F+E) to generate new PU6::sgRNAs by PCR-fusion
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61254 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepCR-Blunt II-TOPO
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 3519
- Total vector size (bp) 4162
-
Vector typeCRISPR ; Cloning template
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namesgRNA(F+E) targeting Y61A9L9.1
-
SpeciesSynthetic
-
Insert Size (bp)643
-
GenBank ID
Cloning Information
- Cloning method TOPO Cloning
- 5′ sequencing primer M13-rev
- 3′ sequencing primer M13-forward (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byU6 promoter was subcloned from pDD162 (AddGene plasmid #47549) and provided by the Goldstein lab.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
target sequence: gaacgaggctgaaaccctga
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pJW1311 was a gift from Jordan Ward (Addgene plasmid # 61254 ; http://n2t.net/addgene:61254 ; RRID:Addgene_61254) -
For your References section:
Rapid and Precise Engineering of the Caenorhabditis elegans Genome with Lethal Mutation Co-conversion and Inactivation of NHEJ Repair. Ward JD. Genetics. 2014 Dec 9. pii: genetics.114.172361. 10.1534/genetics.114.172361 PubMed 25491644