-
PurposeAlso referred to as pRGNndm-1. Expresses Cas9, tracrRNA and a guide RNA which target the NDM-1 gene. Contains a pBBR1 origin and chloramphenicol resistance.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 61270 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backboneCustom pBBR1-CmR
-
Vector typeBacterial Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol, 25 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameCas9, tracrRNA, crRNA
-
Alt nameCRISPR/Cas
-
SpeciesStreptococcus pyogenes
-
Insert Size (bp)5008
- Promoter pLtetO, native, native (respectively)
-
Tag
/ Fusion Protein
- 6xHis (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SalI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer ACGTCTCATTTTCGCCAGAT
- 3′ sequencing primer GAGAAAGCAGGTAGCTTGCAG (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
A portion of this plasmid was derived from a plasmid made byThe Cas9 enzyme was originally cloned from addgene plasmid 39312 (pMJ806). The tracrRNA and crRNA were synthesized.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMM178 was a gift from Timothy Lu (Addgene plasmid # 61270 ; http://n2t.net/addgene:61270 ; RRID:Addgene_61270) -
For your References section:
Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Citorik RJ, Mimee M, Lu TK. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011. 10.1038/nbt.3011 PubMed 25240928