Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pMM178
(Plasmid #61270)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 61270 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    Custom pBBR1-CmR
  • Vector type
    Bacterial Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Cas9, tracrRNA, crRNA
  • Alt name
    CRISPR/Cas
  • Species
    Streptococcus pyogenes
  • Insert Size (bp)
    5008
  • Promoter pLtetO, native, native (respectively)
  • Tag / Fusion Protein
    • 6xHis (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SalI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer ACGTCTCATTTTCGCCAGAT
  • 3′ sequencing primer GAGAAAGCAGGTAGCTTGCAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    The Cas9 enzyme was originally cloned from addgene plasmid 39312 (pMJ806). The tracrRNA and crRNA were synthesized.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMM178 was a gift from Timothy Lu (Addgene plasmid # 61270 ; http://n2t.net/addgene:61270 ; RRID:Addgene_61270)
  • For your References section:

    Sequence-specific antimicrobials using efficiently delivered RNA-guided nucleases. Citorik RJ, Mimee M, Lu TK. Nat Biotechnol. 2014 Sep 21. doi: 10.1038/nbt.3011. 10.1038/nbt.3011 PubMed 25240928