pcrRNA.ind
(Plasmid
#61284)
-
Purpose(Empty Backbone) Arabinose-inducible repeat-only E. coli CRISPR array
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 61284 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD18
- Backbone size (bp) 4653
-
Vector typeBacterial Expression, CRISPR, Synthetic Biology
- Promoter pBAD
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Top10
-
Copy numberHigh Copy
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ctgacgctttttatcgcaactctctactgt
- 3′ sequencing primer GGCTGAAAATCTTCTCTCATCCGCC
- (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pcrRNA.ind was a gift from Chase Beisel (Addgene plasmid # 61284 ; http://n2t.net/addgene:61284 ; RRID:Addgene_61284) -
For your References section:
Repurposing endogenous type I CRISPR-Cas systems for programmable gene repression. Luo ML, Mullis AS, Leenay RT, Beisel CL. Nucleic Acids Res. 2014 Oct 17. pii: gku971. 10.1093/nar/gku971 PubMed 25326321