Skip to main content

pL-SFFV.Reporter.RFP657.PAC
(Plasmid #61395)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 61395 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    RRL.PPT.SFFV.RFP657.IRES2.PAC.PRE
  • Backbone size (bp) 8626
  • Vector type
    Mammalian Expression, Lentiviral
  • Promoter SFFV
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    Stbl3
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer GCTTCCCGAGCTCTATAAAAGAG
  • 3′ sequencing primer TGACAGGTGGTGGCAATGCC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dirk Heckl
  • Articles Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pL-SFFV.Reporter.RFP657.PAC was a gift from Benjamin Ebert (Addgene plasmid # 61395 ; http://n2t.net/addgene:61395 ; RRID:Addgene_61395)
  • For your References section:

    Generation of mouse models of myeloid malignancy with combinatorial genetic lesions using CRISPR-Cas9 genome editing. Heckl D, Kowalczyk MS, Yudovich D, Belizaire R, Puram RV, McConkey ME, Thielke A, Aster JC, Regev A, Ebert BL. Nat Biotechnol. 2014 Jun 22. doi: 10.1038/nbt.2951. 10.1038/nbt.2951 PubMed 24952903